- ntg-context - NTG Mailing Lists

Setting vertical spacing of lines inside a \framed[align=]
by Gerben Wierda 25 Apr '20

25 Apr '20

I have been experimenting with \startpacked..\stoppacked but it doesn’t seem to work. What is the preferred way of getting lines in a normal paragraph (actually, we’re talking about a \framed with align, so a full paragraph in a TeX \vbox) (In addition, I try to find this kind of information first, in the manuals and in ConTeXtgarden, but I am failing. E.g. I look it up in the manual, do not really find it, then look it up in ConTeXt garden but it isn’t really documentend, then click ‘look in source’ and th elink doesn’t work. So, I have to bother people on the list for a basic question like this. I must be doing something wrong and looking in the wrong place) Gerben Wierda Chess and the Art of Enterprise Architecture <https://ea.rna.nl/the-book/> Mastering ArchiMate <https://ea.rna.nl/the-book-edition-iii/> Architecture for Real Enterprises <https://www.infoworld.com/blog/architecture-for-real-enterprises/> at InfoWorld On Slippery Ice <https://eapj.org/on-slippery-ice/> at EAPJ

3 8

PGFPlots does not work with LMTX
by Jairo A. del Rio 25 Apr '20

25 Apr '20

I'm testing LMTX with documents I've written for ConTeXt MKIV. I've copied the third party module folder from ConTeXt and some of them work like a charm (t-vim, TikZ, etc.). Nonetheless, I find PGFPlots just doesn't work. I've tried with the minimal example: \usemodule[pgfplots] \starttext Hola \stoptext and LMTX gives the following error message (omitting spaces): tex error > tex error on line 42 in file pgfplotsbinary.data.code.tex: ! Undefined control sequence l.42 \catcode`\ =11^^I\expandafter\xdef\csname pgfp@bin@ \the\counter^^I\endcsname{^^20}\endgroup\advance\counter by1 lua error: ? <empty file> The control sequence at the end of the top line of your error message was never \def'ed. You can just continue as I'll forget about whatever was undefined. Why does it happen and how to make the code work?

2 1

Re: [NTG-context] Negative width vrule ignored in LuaMETATeX
by Hans Hagen 24 Apr '20

24 Apr '20

On 4/24/2020 7:44 PM, Ao Shen wrote: > Thanks for your timely reply! > > Hans Hagen <j.hagen(a)xs4all.nl> 于2020年4月24日周五下午11:38写道： >> >> no, but i must admit that it's kind of a border case ... i'll fix it but >> also wonder if *no* visual rule showing up is intended (i would then >> also expect an engine to show a rule .. could be an interesting new >> (luametatex) option as it saves kerns in some cases) > > My use cases of negative vrule is a little tricky. I'm trying to comply with > W3C's [Requirements for Japanese Text Layout](https://www.w3.org/TR/jlreq/). > It states that > > In principle, closing brackets (cl-02), commas (cl-07) or full stops (cl-06) > at the line end have a half em space after them (see Fig. 3.20). This half em > space can be deleted for line adjustment. However, the possibilities are only > half em space or solid. Other spaces, such as a quarter em space should not be > used. > > The tricky part is that I also want the opening fullwidth bracket at the > beginning of the line to be solid, i.e., without half em sidebearing on the left > to make the left margin visually more aligned (this is one but not the only way > of line begining handling shown in jlreq). > > To achieve this, in the scripts handler I use the following injector between > 'full_width_close' and 'full_width_open': > > \hskip -0.5em \penalty 100 \hskip 0.5em minus 0.5em \vrule width > -0.5em height 0pt > ^^^(a) ^^^(b) > > If line is broken here, the only broken points are (a) before the glue or (b) at > the penalty point. With the vrule the sidebearing of the opening bracket at > beginning of next line is eliminated. > > In this particular case, a kern is not applicable because it won't survive the > line break. And here a vrule showing nothing is intended. How about something ... \startluacode local classes = fonts.protrusions.classes local vectors = fonts.protrusions.vectors classes.myown = { vector = 'myown', factor = 1, } vectors.myown = table.merged (vectors.quality, { [0x0028] = { 1, 0 }, -- ( [0x0029] = { 0, 1 }, -- ) }) \stopluacode \starttext \showframe \definefontfeature[whatever][default][protrusion=myown] \definedfont[Serif*whatever] \setupalign[hanging] \dorecurse{100}{(#1) } \stoptext of course you need to define the cjk fences etc. Hans ----------------------------------------------------------------- Hans Hagen | PRAGMA ADE Ridderstraat 27 | 8061 GH Hasselt | The Netherlands tel: 038 477 53 69 | www.pragma-ade.nl | www.pragma-pod.nl -----------------------------------------------------------------

1 0

Negative width vrule ignored in LuaMETATeX
by SAO Ocean 24 Apr '20

24 Apr '20

Hi, As I'm beginning to use ConTeXt LMTX, I experimented with it a little and noticed some of my old documents different. After some examination I found the following example: \starttext a\vrule width -5pt height 0pt depth 0pt b \stoptext In LMTX, the result looks as if there is no `\vrule' between `a' and `b'. And if I run with `context --engine=luatex', the expected result is back. I have checked the luametatex manual but it doesn't seem to mention the difference. My luametatex version is mkiv lua stats > used engine: luametatex version: 2.0502, functionality level: 20200413, format id: 493, compiler: clang. Is the behaviour expected? Or shall I use other method to get non-discardable negative space? Ao Shen

3 2

Re: [NTG-context] Basic font question (Optima, but no bold, no italics). Standalone ConTeXt does not work. TeX Live 2019 works
by Benjamin Buchmuller 24 Apr '20

24 Apr '20

Although this specific issue might have been solved meanwhile by the helpful suggestions of Wolfang, Thomas and others, I would like to point out that I have recently also encountered an odd behaviour of the mtxrun fontloader in the standalone, in which not all typefaces are available/properly identified. (I’m sorry to hijack this thread if this is unrelated.) Basically, when I load “Helvetica Neue”, I get instead of “regular/normal” always “light/italic”. I have switched to heros for the meantime, but potentially there is some bug behind this. (My documents with the version from Dec/Jan worked fine.) I recite my example from Wed: ConTeXt ver: 2020.01.30 14:13 MKIV beta fmt: 2020.4.22 (LuaTeX 1.11.1) and I’m running now into troubles with system font indexing: mtxrun --script fonts --reload locates fonts in macOS directories appropriately (*.afm fonts placed in .../tex/texmf-fonts are not found, but at the moment I don’t care too much), however it resolves only to a single font variant for *.ttc instead of all variants: mtxrun --script fonts --list --all --pattern=helvetica helvetica helvetica helveticalightoblique /System/Library/Fonts/Helvetica.ttc 6 helveticalightoblique helvetica helveticalightoblique /System/Library/Fonts/Helvetica.ttc 6 helveticaneuedeskinterfaceheavy helveticaneuedeskinterface helveticaneuedeskinterfaceheavy /System/Library/Fonts/HelveticaNeueDeskInterface.ttc 10 helveticaneuethinitalic helveticaneue helveticaneuethinitalic /System/Library/Fonts/HelveticaNeue.ttc 14 As a consequence, when I run \definefontfamily[mainface][ss][Helvetica Neue] \setupbodyfont[mainface, 12pt, sans] I get the light oblique variant instead of the regular one. I have tried to fix this via a \definefontfamily[mainface][ss][Helvetica Neue][tf=style:normal] but apparently I understand too little about this setup altogether … Thanks already for any suggestions! > On 24 Apr 2020, at 08:53, ntg-context-request(a)ntg.nl wrote: > > Send ntg-context mailing list submissions to > ntg-context(a)ntg.nl > > To subscribe or unsubscribe via the World Wide Web, visit > https://mailman.ntg.nl/mailman/listinfo/ntg-context > or, via email, send a message with subject or body 'help' to > ntg-context-request(a)ntg.nl > > You can reach the person managing the list at > ntg-context-owner(a)ntg.nl > > When replying, please edit your Subject line so it is more specific > than "Re: Contents of ntg-context digest..." > Today's Topics: > > 1. Re: Basic font question (Optima, but no bold, no italics). > Standalone ConTeXt does not work. TeX Live 2019 works > (Wolfgang Schuster) > > From: Wolfgang Schuster <wolfgang.schuster.lists(a)gmail.com> > Subject: Re: [NTG-context] Basic font question (Optima, but no bold, no italics). Standalone ConTeXt does not work. TeX Live 2019 works > Date: 24 April 2020 at 08:53:52 CEST > To: mailing list for ConTeXt users <ntg-context(a)ntg.nl>, Gerben Wierda <gerben.wierda(a)rna.nl> > > > Gerben Wierda schrieb am 24.04.2020 um 08:48: >> With Arial: >> >> \definefontfamily[mainface][rm][Arial] >> \setupbodyfont[mainface,10pt] >> >> <image.png> >> >> with Optima: >> >> \definefontfamily[mainface][rm][Optima] >> \setupbodyfont[mainface,10pt] >> >> <image.png> >> It doesn’t matter if the font statements are before or after \starttext >> >> Then I thought, let’s test some other things. I logged in as another user, and used ConTeXt from TeX Live 2019: >> >> <image.png> >> It seems to be that on my system, the standalone installed ConTeXt does not work with Optima, but the TeX Live installed one does. > > Can you try this: > > \definefontfamily [mainface] [rm] [Optima] > [it=optimaitalic, > bf=optimabold, > bi=optimabolditalic] > > Wolfgang > > > > ___________________________________________________________________________________ > If your question is of interest to others as well, please add an entry to the Wiki! > > maillist : ntg-context(a)ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context > webpage : http://www.pragma-ade.nl / http://tex.aanhet.net > archive : https://foundry.supelec.fr/projects/contextrev/ > wiki : http://contextgarden.net > ___________________________________________________________________________________

4 4

Re: [NTG-context] Hyphentation/Linebreak after x characters
by Benjamin Buchmuller 24 Apr '20

24 Apr '20

Hi Rik, Thanks for the fast reply! Your example works indeed nicely. However, within this solution my problem has shifted now (fully) towards breaking after the same number of characters, which seems to work for your sample string, but not for the sequences that I need to place. What I would like to achieve is something like: 5’-GATTGCTTACTCCTGGTTGG TGGGGCTTACATTCTGTCGCCTC AAAACTACTAGAGCCGGCATATT CTAGAAGGGCCGCCTTCATGTGG etc. (There might be hyphens or not, this is not so much important to me.) But what I get is currently: 5'-GATTGCTTACTCCTG- GTTGGTGGGGCTTACATTCT- GTCGCCTCAAAACTACTA- GAGCCGGCATATTCTA- GAAGGGCCGCCTTCATGTGGC- etc. Which looks ragged with \tt. Certainly, this is because ConTeXt applies the default hyphenation pattern. But I guess, there might be no “no language” pattern or is there? Also, I agree, it’s a bit odd that nright/nleft seem to make no difference towards the result. This is the MWE based on your solution: \define[2]\mycommandc{ \startxrow \startxcell o#1 \stopxcell \startxcell \tt\WORD{5'-#2} \stopxcell \stopxrow } \definebreakpoint[mybreaks][][nright=100,nleft=100,type=1] \setbreakpoints[mybreaks] \starttext \setupxtable[width=5cm] \startxtable \mycommandc{C}{GATTGCTTACTCCTGGTTGGTGGGGCTTACATTCTGTCGCCTCAAAACTACTAGAGCCGGCATATTCTAGAAGGGCCGCCTTCATGTGGCCTAGGGCACCATCGCGTACGAGGGCAAAAAATGAGTTTACCGCTGCGAAGTCTCTACGTCACGGCCAACCACAGTCCTGCTCCCAACGAAATTTAGACGCTGTCGTGAAACCTGAATTCGAGGATAAGCCGCGTCATGAAGAGTCTACTG} \stopxtable \stoptext > On 23 Apr 2020, at 22:02, ntg-context-request(a)ntg.nl wrote: > > Send ntg-context mailing list submissions to > ntg-context(a)ntg.nl > > To subscribe or unsubscribe via the World Wide Web, visit > https://mailman.ntg.nl/mailman/listinfo/ntg-context > or, via email, send a message with subject or body 'help' to > ntg-context-request(a)ntg.nl > > You can reach the person managing the list at > ntg-context-owner(a)ntg.nl > > When replying, please edit your Subject line so it is more specific > than "Re: Contents of ntg-context digest..." > Today's Topics: > > 1. Re: Hyphentation/Linebreak after x characters inside \WORD? > (Rik Kabel) > > From: Rik Kabel <ConTeXt(a)rik.users.panix.com> > Subject: Re: [NTG-context] Hyphentation/Linebreak after x characters inside \WORD? > Date: 23 April 2020 at 21:46:59 CEST > To: ntg-context(a)ntg.nl, benjamin.buchmuller(a)gmail.com > > > > > On 4/23/2020 15:01, Benjamin Buchmuller wrote: >> Sorry, I have just realized that the problem might not be \WORD{} actually, so this one hyphenates: >> >> \define[2]\mycommand{ >> \startxrow >> \startxcell o#1 \stopxcell >> \startxcell \tt\WORD #2 \stopxcell >> \stopxrow >> } >> >> Whereas these ones don’t: >> >> >> \define[2]\mycommand{ >> \startxrow >> \startxcell o#1 \stopxcell >> \startxcell \tt\WORD #2-3' \stopxcell >> \stopxrow >> } >> >> \define[2]\mycommand{ >> \startxrow >> \startxcell o#1 \stopxcell >> \startxcell 5'-\tt\WORD #2 \stopxcell >> \stopxrow >> } >> >> Assuming that this has to do with the presence of “-“ which will be the preferred breakpoint. So, I guess the questions boils down to how to define the second argument of >> >> \definebreakpoint[mybreaks][][nright=12,nleft=12,type=1] >> >> in this case or how to “deactivate” the default \setbreakpoints[compound]? >> >> >> >>> On 23 Apr 2020, at 20:46, Benjamin Buchmuller <benjamin.buchmuller(a)gmail.com> >>> wrote: >>> >>> Hi again, >>> >>> I am reading a CSV file into ConTeXt which contains long DNA sequences (>> 40 characters) to place in xtables. So far, this works fine. However, I need to uppercase the entries and need to \tt them. When I do this inside \WORD however, they don’t hyphenate any more. >>> >>> I’m using: >>> >>> \defineseparatedlist >>> [mylist] >>> [ >>> separator={,}, quotechar={"}, >>> command=\mycommand >>> ] >>> >>> \define[2]\mycommand{ >>> \startxrow >>> \startxcell o#1 \stopxcell >>> \startxcell 5’-{\tt\WORD{#2}}-3' \stopxcell >>> \stopxrow >>> } >>> >>> Since I don’t have access to each entry, I cant place hyphenation marks directly. Is there a way to tell ConTeXt to hyphenate after say, 12 characters? >>> >>> Thanks for your help. >>> >>> >>> Benjamin >>> > The following works for me: > > \define[2]\mycommanda{ > \startxrow > \startxcell o#1 \stopxcell > \startxcell \tt\WORD #2 \stopxcell > \stopxrow > } > > \define[2]\mycommandb{ > \startxrow > \startxcell o#1 \stopxcell > \startxcell \tt\WORD #2-3' \stopxcell > \stopxrow > } > > \define[2]\mycommandc{ > \startxrow > \startxcell o#1 \stopxcell > \startxcell 5'-\tt\WORD #2 \stopxcell > \stopxrow > } > > \definebreakpoint[mybreaks][][nright=12,nleft=12,type=1] > \setbreakpoints[mybreaks] > > \starttext > > \setupxtable[width=5cm] > \startxtablex > \mycommanda{A}{lsfkgjfkgshgkhigewhgajkdkfkalhfdklahfkhaakfakfh} > \mycommandb{B}{lsfkgjfkgshgkhigewhgajkdkfkalhfdklahfkhaakfakfh} > \mycommandc{C}{lsfkgjfkgshgkhigewhgajkdkfkalhfdklahfkhaakfakfh} > \stopxtable > > \stoptext > > > Producing: > > <nijiabomaaejpjhk.png> > > Indeed, it produces the same when nleft and nright are both set to 1 or 12 or 100, but not when setbreakpoints is removed. > > If you are trying to do something else, please provide an MWE. > > > ___________________________________________________________________________________ > If your question is of interest to others as well, please add an entry to the Wiki! > > maillist : ntg-context(a)ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context > webpage : http://www.pragma-ade.nl / http://tex.aanhet.net > archive : https://foundry.supelec.fr/projects/contextrev/ > wiki : http://contextgarden.net > ___________________________________________________________________________________

3 4

Basic font question
by Gerben Wierda 24 Apr '20

24 Apr '20

On my Mac, I am trying: \definefontfamily[mainface][rm][Optima] \setupbodyfont[mainface,10pt] {\bf Bold} and {\it Italic} and {\rm Regular} text. What do I need to do to get actual bold and italics in my output? Thx, G

6 16

Hyphentation/Linebreak after x characters inside \WORD?
by Benjamin Buchmuller 23 Apr '20

23 Apr '20

Hi again, I am reading a CSV file into ConTeXt which contains long DNA sequences (>> 40 characters) to place in xtables. So far, this works fine. However, I need to uppercase the entries and need to \tt them. When I do this inside \WORD however, they don’t hyphenate any more. I’m using: \defineseparatedlist [mylist] [ separator={,}, quotechar={"}, command=\mycommand ] \define[2]\mycommand{ \startxrow \startxcell o#1 \stopxcell \startxcell 5’-{\tt\WORD{#2}}-3' \stopxcell \stopxrow } Since I don’t have access to each entry, I cant place hyphenation marks directly. Is there a way to tell ConTeXt to hyphenate after say, 12 characters? Thanks for your help. Benjamin

2 2

useexternaldocument with custom file type
by Jan U. Hasecke 23 Apr '20

23 Apr '20

Hi, can I link to a file with custom file type eg. OpenDocument with \useexternaldocument? This does not work. \useexternaldocument[test][test.ods][A test document] As the PDF viewer is opened first, it does not recognize the file type. juh

4 8

Is there a 'sized' command equivalent to \colored?
by Gerben Wierda 23 Apr '20

23 Apr '20

I can directly colour a text in rgb by doing \colored[r=0.8,b=0.6,c=0.4]{Text}. Suppose I want to hard code a piece of text as 12.8pt, is there a simple way to do that directly like with \colored for colour? G

1 1